Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.010460 |
Chromosome: | chromosome 3 |
Location: | 6057074 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g800353 | (1 of 1) K06631 - polo-like kinase 1 (PLK1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCGGCGACCACTAACAGGTTGCAACTCTGCGCCGTCTACCTGCAGGCT |
Internal bar code: | GGATCCCGGGAACGCTGCGGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2097 |
LEAP-Seq percent confirming: | 85.7143 |
LEAP-Seq n confirming: | 12 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCCTACTGCTTCAGGTTGC |
Suggested primer 2: | GATCCGCACGTTTCACATCG |