Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.010510 |
Chromosome: | chromosome 13 |
Location: | 842021 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g567300 | (1 of 1) PTHR18968//PTHR18968:SF86 - THIAMINE PYROPHOSPHATE ENZYMES // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGACGGTGACCACCTCGCCACCCAGCCCTGATGATGACACGACACACGG |
Internal bar code: | TATGAGAATAAGTTTGTATAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3073 |
LEAP-Seq percent confirming: | 86.8421 |
LEAP-Seq n confirming: | 33 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCTTACTTGGGATTGGGCT |
Suggested primer 2: | TCAACAACAGTGCGGCAATG |