| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.010532 |
| Chromosome: | chromosome 7 |
| Location: | 5314315 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g349950 | (1 of 1) K03131 - transcription initiation factor TFIID subunit 6 (TAF6) | 5'UTR_intron | |
| Cre07.g349966 | (1 of 8) 2.3.1.75 - Long-chain-alcohol O-fatty-acyltransferase / Wax synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGCACAGAGAGCAAAAGAAGCGCGAAGGACCACGATAGAAGACAGTCA |
| Internal bar code: | ACCATTTGTCACTGACAGTAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1348 |
| LEAP-Seq percent confirming: | 90.9091 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGATGGCACCCCTGTTCT |
| Suggested primer 2: | AGGCTTGTCATCAGTGGACG |