| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.010557 |
| Chromosome: | chromosome 11 |
| Location: | 4430654 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g483250 | PHC45 | (1 of 8) 3.1.1.13//3.1.1.3 - Sterol esterase / Triterpenol esterase // Triacylglycerol lipase / Triglyceride lipase; Putative pherophorin-chlamydomonas homolog | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCAGCTACCCACAGCCGTGAAGCAGAAGGTCGTGGAGGAGGCCTGGGCG |
| Internal bar code: | TATGTGTAAATGTCTGTTCACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 932 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 23 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACACTTCCACACGCTTG |
| Suggested primer 2: | GACGCCGACATCCTAGTCTG |