| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.010565 |
| Chromosome: | plastome |
| Location: | 12211 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802267 | ChreCp005,2716979,tufA | elongation factor 1-alpha; (1 of 1) PTHR23115//PTHR23115:SF146 - TRANSLATION FACTOR // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCTGTTGTTACTGGTTTAGAAATGTTCAAAAAAACATTAGATGAAACT |
| Internal bar code: | GCGTTGAGCTACAGGCTAAAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1368 |
| LEAP-Seq percent confirming: | 72.7273 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAAAGGGGACGTCCGTTAA |
| Suggested primer 2: | ATGATCACAGGTGCTGCACA |