| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.010592 |
| Chromosome: | chromosome 5 |
| Location: | 614920 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g244900 | (1 of 1) PF01594 - Domain of unknown function DUF20 (UPF0118) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACAGCCGCGCCCGTGCCCGCATTGCGTTCGCTGCTGCGGCTGCGGATGG |
| Internal bar code: | TCGCCGCAAGTAGGTCTAAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3059 |
| LEAP-Seq percent confirming: | 73.6842 |
| LEAP-Seq n confirming: | 84 |
| LEAP-Seq n nonconfirming: | 30 |
| LEAP-Seq n unique pos: | 114 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACTGTAGGGGTTGGGACAC |
| Suggested primer 2: | ACAGTTGCCACTCTCTCACG |