Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.010619 |
Chromosome: | chromosome 3 |
Location: | 683967 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g145767 | RRP6,RRP6a | putative exosome subunit; (1 of 1) K12951 - cation-transporting P-type ATPase D (ctpD) | 3'UTR |
Cre03.g145787 | HSP22C | (1 of 1) IPR000104//IPR002068//IPR008978//IPR031107 - Antifreeze protein, type I // Alpha crystallin/Hsp20 domain // HSP20-like chaperone // Small heat shock protein HSP20; Heat shock protein 22C | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATCTGAAGCAGCTCATCCATGGCTCGTGAAAGGCTGCCCAGGCTGGAC |
Internal bar code: | AGTGGAGGGTACCCTTACATGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1107 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 54 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 54 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCCTTCTCCGTTTACGCAG |
Suggested primer 2: | CTCGATGTGCAGGTCCGATT |