Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.010651 |
Chromosome: | chromosome 11 |
Location: | 3900835 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g479850 | CYN59 | Cyclophilin 59; (1 of 1) K12735 - peptidyl-prolyl cis-trans isomerase-like 4 [EC:5.2.1.8] (PPIL4) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGCTGGGTGTACGGACTTCGCCACTTTCACACTCGTTCCGCCAGGCCG |
Internal bar code: | ATGTTATAGCTCATGCGTCAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 711 |
LEAP-Seq percent confirming: | 89.6552 |
LEAP-Seq n confirming: | 26 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGTACGGGCTGGACAATGT |
Suggested primer 2: | ACACACATGCTGCTCAGACA |