| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.010714 |
| Chromosome: | chromosome 11 |
| Location: | 3694817 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g478750 | FKB2,FKB15-2,FKB15B | Peptidyl-prolyl cis-trans isomerase, FKBP-type; (1 of 1) PTHR10516//PTHR10516:SF305 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTCGCTTTATCTGGCCCCCCGCTTTTACAAGGCACTACTGGAGACGCA |
| Internal bar code: | AAATCACGCGTGCCTGAAGGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1581 |
| LEAP-Seq percent confirming: | 97.7273 |
| LEAP-Seq n confirming: | 43 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGTCTATCCCCCAGTCCCA |
| Suggested primer 2: | CTGGTGTTCGATGTGGAGCT |