| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.010715 |
| Chromosome: | chromosome 17 |
| Location: | 71519 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g696350 | (1 of 1) PTHR12454:SF11 - PROTEIN Y57A10A.10 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTCTGCATTCCCAGGACAGGGCATGACGAACTGAGCGTTAAACCCGAT |
| Internal bar code: | TAGGTGGAAAAGTGCTTACATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4822 |
| LEAP-Seq percent confirming: | 74.5098 |
| LEAP-Seq n confirming: | 114 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 153 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACTAGATTTGCGAAGGCG |
| Suggested primer 2: | GTCCGGCTGTAATACCTCCG |