Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.010717 |
Chromosome: | chromosome 7 |
Location: | 5216739 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g349100 | HEL39 | ATP-dependent RNA helicase; (1 of 1) K12813 - pre-mRNA-splicing factor ATP-dependent RNA helicase DHX16 (DHX16) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCGACACAGACACTCCTTTGGCTTTTACTGATTCGCCTCCTACGGCGG |
Internal bar code: | CAATTGGGCTTATGAGTCAACA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 759 |
LEAP-Seq percent confirming: | 34.0 |
LEAP-Seq n confirming: | 17 |
LEAP-Seq n nonconfirming: | 33 |
LEAP-Seq n unique pos: | 50 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTTGGTGGCTGGAGCAAAG |
Suggested primer 2: | GGGCTCAAAGATCTTGGCCT |