| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.010834 |
| Chromosome: | chromosome 1 |
| Location: | 2836049 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g017600 | PQQ2 | (1 of 8) IPR011047//IPR018391 - Quinonprotein alcohol dehydrogenase-like superfamily // Pyrrolo-quinoline quinone beta-propeller repeat; Putative quinoprotein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCGCCCTGGCTCTGGGCAGCGATGGGCCTACAGAGGTCATGTGAGTTC |
| Internal bar code: | GACCGATTACTGTACCCTCAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1191 |
| LEAP-Seq percent confirming: | 29.2683 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGTCAGCAAGGGGTTACGT |
| Suggested primer 2: | TGCTATAGGGGAACTGGCCT |