| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.010925 |
| Chromosome: | chromosome 10 |
| Location: | 6444181 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g464850 | MSRA5 | (1 of 2) PTHR10173//PTHR10173:SF34 - METHIONINE SULFOXIDE REDUCTASE // SUBFAMILY NOT NAMED; Peptide methionine-S-sulfoxide reductase, msrA-type | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGGTCCGCGAGTGGCCCAGGTGGCGAGGACGCTCCCAACCCGTTTTGC |
| Internal bar code: | TCACCTCGATTTGTGAGTCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1559 |
| LEAP-Seq percent confirming: | 4.22535 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 68 |
| LEAP-Seq n unique pos: | 71 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGAGTAGGATTCGGCGGG |
| Suggested primer 2: | CAACCCCACATCCAGCTGAT |