Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.010938 |
Chromosome: | chromosome 9 |
Location: | 5754883 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g410800 | NRT2B,NAR4 | (1 of 4) K02575 - MFS transporter, NNP family, nitrate/nitrite transporter (NRT, narK, nrtP, nasA); High affinity nitrate transporter | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAATTAAGTAGCTTGCCCCGTCGTCCGCGTGCCCCGCCCTCCGTCACGG |
Internal bar code: | TATTTGGACCAGTTTTTGTTGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3623 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 52 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 52 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACAGAGGAAAGCGGTGGATG |
Suggested primer 2: | GTGTGTTCCGCAAAAGGCAT |