| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.010967 |
| Chromosome: | chromosome 14 |
| Location: | 1170246 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g615350 | THB2 | Truncated hemoglobin; (1 of 2) IPR016339 - Truncated hemoglobin, group 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAGGATAACGGCCGTGTACGGGGCACGGTGCAGGATCGTCGTGCCGCT |
| Internal bar code: | TAACACCAAACCTATGTTCATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3079 |
| LEAP-Seq percent confirming: | 56.7308 |
| LEAP-Seq n confirming: | 59 |
| LEAP-Seq n nonconfirming: | 45 |
| LEAP-Seq n unique pos: | 104 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGTCCATACCGACAGTCGC |
| Suggested primer 2: | TCCCATATGTCCAGCCCTCA |