Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.011011 |
Chromosome: | chromosome 11 |
Location: | 862493 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467649 | OPR107 | OctotricoPeptide Repeat protein 107; (1 of 1) IPR010622//IPR016024 - FAST kinase leucine-rich // Armadillo-type fold | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGCCCATTGTCTCTCGCGACTCGGCCGACAGCCCCAGGTAAGGCCAGG |
Internal bar code: | GTTGATGTCATTACGCAGGGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2343 |
LEAP-Seq percent confirming: | 96.875 |
LEAP-Seq n confirming: | 31 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGAAATGGCAGGAGGAGGC |
Suggested primer 2: | CTCCACACCCGACATCCAAA |