| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.011035 |
| Chromosome: | chromosome 14 |
| Location: | 2129508 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g621751 | USP,USP2,UAP2 | (1 of 1) 2.7.7.64 - UTP-monosaccharide-1-phosphate uridylyltransferase / USP; Wide substrate-specificity UDP-sugar pyrophosphorylase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCATGATTCCACCTTGCCACCCCCCTGCGCACAGCCTGCTGTGTTGCC |
| Internal bar code: | GGGTCTACAACATGGTCGTTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 128 |
| LEAP-Seq percent confirming: | 5.12821 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 37 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATCTCCACGGAGCTCTAC |
| Suggested primer 2: | CTCCCATCCACGTGAACACA |