| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.011070 |
| Chromosome: | chromosome 16 |
| Location: | 2910411 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g663350 | CLPX1,CLPX | ClpX chaperone; (1 of 1) K03544 - ATP-dependent Clp protease ATP-binding subunit ClpX (clpX, CLPX) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGCGGCTTCAAGCGCACCACACGCGGATGAGACCAGCCAAGACCGCAG |
| Internal bar code: | GTAGGTGTATGCGATAAGCGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1165 |
| LEAP-Seq percent confirming: | 94.8718 |
| LEAP-Seq n confirming: | 37 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACAGCAGCAACACACACAG |
| Suggested primer 2: | TGTTGCCGTTGATGTTGCTG |