| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.011104 |
| Chromosome: | chromosome 1 |
| Location: | 2710773 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g016450 | (1 of 1) IPR000104//IPR001214//IPR002893 - Antifreeze protein, type I // SET domain // Zinc finger, MYND-type; SET domain protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGGCAACAGAGGCGGCGTCGGGGCCTGGGGCGGCGGCGACGGACAGTGC |
| Internal bar code: | AGGTTATCGCTTAACCGAAGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1613 |
| LEAP-Seq percent confirming: | 95.1219 |
| LEAP-Seq n confirming: | 39 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGTATCACCCAGCAGGCTG |
| Suggested primer 2: | GGGCTAGGGTCTGTAGGTGA |