| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.011128 |
| Chromosome: | chromosome 7 |
| Location: | 2999580 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g333450 | SGT1 | Sterol 3-beta-glucosyltransferase; (1 of 2) 2.4.1.173 - Sterol 3-beta-glucosyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAAGACATCAATAGCCCGTCCAATGTCATCCGCCGTCAGCTTGTCGATG |
| Internal bar code: | CAGCCTGGGCCAGCGGCACGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 264 |
| LEAP-Seq percent confirming: | 2.08333 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 47 |
| LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCTGGGGTCTGCTAATTGT |
| Suggested primer 2: | GAATTCGGAAGCATCGTGCC |