| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.011148 |
| Chromosome: | chromosome 12 |
| Location: | 9879181 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g543477 | (1 of 98) IPR023214 - HAD-like domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTCCAGCTCGCCGCCCACCAGGGTGTCATCCAGGTCGCATATGAGCACC |
| Internal bar code: | TCTCGGTCGATAATCGCTGTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1394 |
| LEAP-Seq percent confirming: | 92.8571 |
| LEAP-Seq n confirming: | 117 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 126 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCCTATCTCCTGGAGCCTT |
| Suggested primer 2: | GGGTGGGGAACAACTAGAGC |