Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.011210 |
Chromosome: | chromosome 14 |
Location: | 923239 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g613400 | POC16 | Proteome of centriole protein 16; (1 of 1) PTHR13720//PTHR13720:SF27 - WD-40 REPEAT PROTEIN // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCAGTTGCGAGATTAGGAATGCACCGCTGTCGTGCCCATCTGCCGGCTT |
Internal bar code: | GCTTTATTTACCTCATCGTCTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 271 |
LEAP-Seq percent confirming: | 5.12821 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 37 |
LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCAACTCCACACCATTCCCG |
Suggested primer 2: | CTGGAATCCCCCAACCTTCC |