Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.011224 |
Chromosome: | plastome |
Location: | 162218 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802324 | tic214,orf1995,ycf1,2717035,ChreCp059 | Forms with TIC20, TIC56 and TIC100 the 1-MD complex mediating chlorolast protein import | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACAAAAGCAGGTAATAATAATATCAAAAAGAAAACTTTAATTATTAGTC |
Internal bar code: | AGTGTCATGGTTCTTACCCCAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 998 |
LEAP-Seq percent confirming: | 66.6667 |
LEAP-Seq n confirming: | 12 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCTTGAAGGTCTCCAACGT |
Suggested primer 2: | CATCGCCAACAACTTCACGT |