| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.011257 |
| Chromosome: | chromosome 11 |
| Location: | 510714 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467596 | (1 of 7) IPR011335 - Restriction endonuclease type II-like | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGAGATCGTCATGGGCGCCATTCGTTGTGCTTAGATGACGTTTGAGGC |
| Internal bar code: | AGCTCTGGTCCGCGGCTGTAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1914 |
| LEAP-Seq percent confirming: | 80.8696 |
| LEAP-Seq n confirming: | 93 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 115 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACCTCGGTTTAGTGTCCA |
| Suggested primer 2: | GAGGCGGTTGAGTGTTGAGA |