Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.011290 |
Chromosome: | chromosome 12 |
Location: | 6021348 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g534550 | PHR4 | (1 of 1) PTHR11455:SF2 - BLUE-LIGHT PHOTORECEPTOR PHR2; Putative photolyase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGTCGCCCCAATGTACTCCTCGGCACCGACCGGGCTGCACTGGGCTGT |
Internal bar code: | AGAGGTGTGCCTTGGCGTCTAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1641 |
LEAP-Seq percent confirming: | 69.5652 |
LEAP-Seq n confirming: | 16 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCAGCGACATGATAGACGA |
Suggested primer 2: | CCTCCTGTTTCCCGACACTC |