Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.011305 |
Chromosome: | chromosome 2 |
Location: | 1437723 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g083550 | (1 of 1) PF01494//PF05834 - FAD binding domain (FAD_binding_3) // Lycopene cyclase protein (Lycopene_cycl) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTTGCTTATGCTGCCGAAACCCATGGCCGTGACGCTGATCTAAGGCGC |
Internal bar code: | GCTCACGCGTTAATTCAATATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 174 |
LEAP-Seq percent confirming: | 30.2326 |
LEAP-Seq n confirming: | 13 |
LEAP-Seq n nonconfirming: | 30 |
LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGGTTGATGTGGTTGTGGC |
Suggested primer 2: | GGTGCATGTGTGTAGGTGGG |