Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.011325 |
Chromosome: | chromosome 12 |
Location: | 1191040 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g490451 | (1 of 16) IPR011044 - Quinoprotein amine dehydrogenase, beta chain-like | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGTTACAACCCCCTCAAGTCAGACCCCGCCTCACTCGCCTCGCTGCCA |
Internal bar code: | TTGTAAATGTCCGGCACCTTAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2922 |
LEAP-Seq percent confirming: | 97.619 |
LEAP-Seq n confirming: | 123 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 126 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCAAGAATCGCATTCCCAG |
Suggested primer 2: | CCCGCCCTCATGTTACTTGT |