Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.011326 |
Chromosome: | chromosome 1 |
Location: | 2805846 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g017250 | FKB99 | Chlorophyceae-specific protein; (1 of 2) K09571 - FK506-binding protein 4/5 (FKBP4_5) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCCTCGTCCACTCGGCGGCTTGCCGCGGCCCGGCCCGGACCGCCCGCC |
Internal bar code: | TCTTGGAGGGAGGGCTTATGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 976 |
LEAP-Seq percent confirming: | 3.66972 |
LEAP-Seq n confirming: | 4 |
LEAP-Seq n nonconfirming: | 105 |
LEAP-Seq n unique pos: | 109 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTACACCAGCAACCTGTCGT |
Suggested primer 2: | GCAGGCTCCATTCAAGTCCT |