| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.011386 |
| Chromosome: | chromosome 2 |
| Location: | 849161 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g078858 | PSN1 | Presenilin protease; (1 of 1) K04505 - presenilin 1 (PSEN1, PS1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCCAGGGAGGGCGGTTGCTGAGCTTTGCTTGGAATCGGTTTAGGCGGCA |
| Internal bar code: | CGTCTTATTTGGAACGTATGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1865 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 55 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 55 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACTTGTGGAAGCACTGGC |
| Suggested primer 2: | TTTCATGCCCTGGAGTGGAC |