| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.011407 |
| Chromosome: | chromosome 5 |
| Location: | 2869490 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g241450 | FTSY1,FTSY | (1 of 1) K03110 - fused signal recognition particle receptor (ftsY); Chloroplast SRP Receptor | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGGGAAAAGGGTCGATACCATTTAAATGCGTGGGGTTGCGGCGTTGTAT |
| Internal bar code: | CTGATCCTGATAGTATTGAAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 400 |
| LEAP-Seq percent confirming: | 69.2308 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGACTGCAACCCAACTGC |
| Suggested primer 2: | CCACAGGCCTCAACATGCTA |