| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.011454 |
| Chromosome: | chromosome 6 |
| Location: | 8069453 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g305250 | (1 of 90) PF03372 - Endonuclease/Exonuclease/phosphatase family (Exo_endo_phos) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCTGCGCACGCAACCCATTGCATTCAGAAGAAGTCTCGATAAGCATTT |
| Internal bar code: | GGCACTTCTGCAGGTTGCGATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2824 |
| LEAP-Seq percent confirming: | 76.9231 |
| LEAP-Seq n confirming: | 40 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 52 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGGACGGTGTCTCCATACT |
| Suggested primer 2: | GCAGGACACTAACGAACCCA |