Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.011461 |
Chromosome: | plastome |
Location: | 4956 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802264 | petD,ChreCp002,2717021 | cytochrome b6/f complex subunit 4; (1 of 1) K02637 - cytochrome b6-f complex subunit 4 (petD) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGCTAATTTTGCTTTTAAAACTGGATCGCTTAAATCAGGTTTTTTAGTA |
Internal bar code: | GGTTCGGAATGCGTGACCGCCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 79 |
LEAP-Seq percent confirming: | 8.33333 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCCTTCGGGCAAGTAAACT |
Suggested primer 2: | AGCGATTGGACGACGGTATG |