Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.011557 |
Chromosome: | chromosome 16 |
Location: | 7033339 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g802001 | (1 of 70) PF07282 - Putative transposase DNA-binding domain (OrfB_Zn_ribbon) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGATTTGGTCCCCGCCCCAACCTGCTGATGCAACCGCCATGACCAGTG |
Internal bar code: | CTGATGAATGGCTTGTTAGCGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3776 |
LEAP-Seq percent confirming: | 98.1818 |
LEAP-Seq n confirming: | 54 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 55 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGGCAGCCACCACTAATCA |
Suggested primer 2: | GTCGGGAGGGTAGAGTGAGT |