| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.011673 |
| Chromosome: | chromosome 7 |
| Location: | 6470460 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g800879 | (1 of 1) IPR000477//IPR002035 - Reverse transcriptase domain // von Willebrand factor, type A | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGACGTTCCTGTCAGAGGCCATGGAGGCCGCTGGTGCAGGCCCTAACC |
| Internal bar code: | GGTTACTAGTTTTTGCCGCTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4008 |
| LEAP-Seq percent confirming: | 3.67647 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 131 |
| LEAP-Seq n unique pos: | 136 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGGCGTTCTAGCTGGTCA |
| Suggested primer 2: | CAACCGAGGATGACACCACA |