| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.011746 |
| Chromosome: | chromosome 8 |
| Location: | 562651 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g359700 | LAS1,LIPA1 | (1 of 2) 2.8.1.8 - Lipoyl synthase / Lipoate synthase; Lipoic acid synthetase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGCGCGGTGCGGGCCCTCCTCCATCGTTGCTGTTGCTACATCGCCCCCC |
| Internal bar code: | ACGGGAGATCTAGTTCGAATGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1351 |
| LEAP-Seq percent confirming: | 84.6154 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGGACTCGGGCAAGTAACC |
| Suggested primer 2: | CAAACGGTTTGCAGGTGAGG |