Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.011778 |
Chromosome: | chromosome 6 |
Location: | 1467509 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g260400 | FAP287 | (1 of 1) PF13881 - Ubiquitin-2 like Rad60 SUMO-like (Rad60-SLD_2); Ubiquitin-like Flagellar Associated Protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGCCCTCCTATCTACCTTACACGGCACTTTCCACGCGGAGTCACCCTCC |
Internal bar code: | AACTTTTGCGACATATTGCAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1864 |
LEAP-Seq percent confirming: | 97.5 |
LEAP-Seq n confirming: | 39 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGTCGCTCAAGGACAAGGTG |
Suggested primer 2: | CCCATGCACTCTGTCCTGTT |