Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.011816 |
Chromosome: | chromosome 6 |
Location: | 5276183 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g284400 | (1 of 1) K06695 - 26S proteasome regulatory subunit, ATPase 3, interacting protein (PSMC3IP) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACGGAAAGTGAGGCAGACGGGCCCAGCGCCGCCCAGCTCCGAGGGTTGT |
Internal bar code: | GCGTGTTTAGATAGGACAGTTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 394 |
LEAP-Seq percent confirming: | 82.7586 |
LEAP-Seq n confirming: | 24 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTTGTGCTCTCTGACACGT |
Suggested primer 2: | AGCCCAGATCGAGCGTATTG |