| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.011883 |
| Chromosome: | chromosome 13 |
| Location: | 1041492 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g568600 | IPP9 | Multiple inositol-polyphosphate phosphatase; (1 of 1) 3.1.3.62//3.1.3.8 - Multiple inositol-polyphosphate phosphatase / MIPP // 3-phytase / Phytate 6-phosphatase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACGGCAGGCCCCCTCAACCTTCCACCGCATGTCTGCCCCCGCTCGTGGG |
| Internal bar code: | ACTGCCCGACCCAGTATCCTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 72 |
| LEAP-Seq percent confirming: | 80.0 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACCACAGTGTAATCCCCC |
| Suggested primer 2: | AAAGAGTCACGGACACGCAT |