| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.012165 |
| Chromosome: | chromosome 7 |
| Location: | 156288 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g313164 | (1 of 2) K16296 - serine carboxypeptidase-like clade I [EC:3.4.16.-] (SCPL-I) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTCCGCCGTGTCCATGGCGTAGTACAGCACGTCGCTGCAGGGCTGCCAG |
| Internal bar code: | AACTCTTACTGTATGCTCGTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1031 |
| LEAP-Seq percent confirming: | 85.7143 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAAGATTCCCACACCCGCAC |
| Suggested primer 2: | GAGAGAGCGCCTAGAACGTC |