| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.012238 |
| Chromosome: | chromosome 16 |
| Location: | 977416 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g648750 | (1 of 1) PF10373 - Est1 DNA/RNA binding domain (EST1_DNA_bind) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAACAATTGATCTGTTACCACCGCTAATGCCACCTGTACGGCGCACAGG |
| Internal bar code: | ACCAAAGTTGGTTAGGACACTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 508 |
| LEAP-Seq percent confirming: | 9.09091 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAAGCGGTCCGTATCCATG |
| Suggested primer 2: | GCCACACCTGCTTTTGTACG |