| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.012280 |
| Chromosome: | chromosome 7 |
| Location: | 2340364 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g328200 | PSBP6 | (1 of 1) PTHR31407//PTHR31407:SF7 - FAMILY NOT NAMED // PSBP DOMAIN-CONTAINING PROTEIN 5, CHLOROPLASTIC; PsbP-like protein of thylakoid lumen | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGCCAGCGACGAGGCCAGCGCCTGGCGACGGCTCACGGCCAGCTCATC |
| Internal bar code: | CTCTTTCAAATGATCATCTACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2340 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 51 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCTGAGCGACACGTGTTTA |
| Suggested primer 2: | TGCTGTACTTCTCAGGCGTG |