Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.012315 |
Chromosome: | chromosome 16 |
Location: | 4677740 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g667350 | CAV6 | (1 of 2) PF00520//PF08016//PF16905 - Ion transport protein (Ion_trans) // Polycystin cation channel (PKD_channel) // Voltage-dependent L-type calcium channel, IQ-associated (GPHH); Voltage-gated Ca2+ channel, alpha subunit | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATCATGAATGTAACCCCCCCCCCCCACACACACGCACCCTCGCACAGAC |
Internal bar code: | GGTTCGAGGGTCTCTTTTTGTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 967 |
LEAP-Seq percent confirming: | 94.4444 |
LEAP-Seq n confirming: | 17 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTCACGCTCCTGAACCTGT |
Suggested primer 2: | AAGAAACGCACAACACGTCG |