| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.012326 |
| Chromosome: | chromosome 3 |
| Location: | 93191 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g800279 | (1 of 1) PF00059//PF13229 - Lectin C-type domain (Lectin_C) // Right handed beta helix region (Beta_helix) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCAGTAGCCTGCGACTTTCGGGGCCGGCCTCCGCCCCTGGCCTTGTCAT |
| Internal bar code: | TTTTGTCCGATTTGTCCCAGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4064 |
| LEAP-Seq percent confirming: | 79.6296 |
| LEAP-Seq n confirming: | 43 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 54 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACGAATAACATCACCGCC |
| Suggested primer 2: | GGACTCCTTGTAAGGTGGGC |