| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.012366 |
| Chromosome: | chromosome 3 |
| Location: | 6579048 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g194600 | (1 of 2) IPR000719//IPR011009//IPR013221 - Protein kinase domain // Protein kinase-like domain // Mur ligase, central | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCTAAGGACTGACCCGCATGTCAGCCCGGCCCAGGCCGGAACGTAAAC |
| Internal bar code: | CATTGCGAGTCATGTTGTCGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2183 |
| LEAP-Seq percent confirming: | 0.70922 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 140 |
| LEAP-Seq n unique pos: | 141 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGCCAATTGTCCGCAATAG |
| Suggested primer 2: | GCAGATCCACCTCCATCTGG |