Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.012537 |
Chromosome: | chromosome 7 |
Location: | 5327549 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g350000 | TGL14 | (1 of 2) PTHR21493//PTHR21493:SF119 - CGI-141-RELATED/LIPASE CONTAINING PROTEIN // TRIGLYCERIDE LIPASE-RELATED; Putative triacylglycerol lipase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTTGGCCACACCCGCCACGGCCTGACCCGCCGCCGCCGTGGCCCCGGT |
Internal bar code: | ATTGAATATACTTTCTTTGATA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2915 |
LEAP-Seq percent confirming: | 78.5714 |
LEAP-Seq n confirming: | 11 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCGTTCCATCTTCACCAGCC |
Suggested primer 2: | TTGACTTCCGTCCTCAGTGC |