| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.012544 |
| Chromosome: | chromosome 13 |
| Location: | 3547371 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g587800 | NUP188 | (1 of 1) PTHR31431:SF1 - NUCLEOPORIN NUP188 HOMOLOG; Nucleoporin 188 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGGCTGCTGCACCGCCGCCGGCCGCACCGCCCGCGGCCTCTTTGAGTC |
| Internal bar code: | GTAGTCTTTTGGAATCATGAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1976 |
| LEAP-Seq percent confirming: | 82.7586 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAACTGCTAGCGTTGCTCT |
| Suggested primer 2: | GCGTACTGGCTGATCTGGTT |