| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.012559 |
| Chromosome: | chromosome 16 |
| Location: | 887126 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g648100 | (1 of 1) K05757 - actin related protein 2/3 complex, subunit 1A/1B (ARPC1A_B) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATACCTCAGCACGCACACACGCGCCCTACGATGCTGCCGGTCCATCCG |
| Internal bar code: | CAGAGTTACTTGTCTTAGAAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1713 |
| LEAP-Seq percent confirming: | 85.7143 |
| LEAP-Seq n confirming: | 36 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 42 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACACACACACACACCT |
| Suggested primer 2: | TTGTTTGAGGTGGGCAGTGT |