| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.012591 |
| Chromosome: | chromosome 4 |
| Location: | 1654663 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g212700 | (1 of 19) PTHR31251//PTHR31251:SF1 - FAMILY NOT NAMED // SQUAMOSA PROMOTER-BINDING-LIKE PROTEIN 10-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGCGCGCATGGCCGGACGGGGGCGCGGATGGCGCACTGGCGTGAAGTA |
| Internal bar code: | CGATATTGAATATTCTATTCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3426 |
| LEAP-Seq percent confirming: | 96.7742 |
| LEAP-Seq n confirming: | 30 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCGATGTACGGCATGGAT |
| Suggested primer 2: | TCAACGCGGGGCTATCATAC |