| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.012609 |
| Chromosome: | chromosome 11 |
| Location: | 3151870 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g475650 | (1 of 11) IPR017956 - AT hook, DNA-binding motif | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGCGCGCCTCCCGCCCGCAGCCCCACCCCGGGCCCCGGACCCCCTTGT |
| Internal bar code: | AGAAGATAACTTTTTTCTCTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 789 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCCTCGTCCTCGTCTTCG |
| Suggested primer 2: | AACAGCCAGTATGCACGTGA |