| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.012668 |
| Chromosome: | chromosome 8 |
| Location: | 3033617 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g375150 | (1 of 1) PF11904//PF12796 - GPCR-chaperone (GPCR_chapero_1) // Ankyrin repeats (3 copies) (Ank_2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGTGCGGGTAGCCAGCCACCTTACCTTGTCTTTCAACCCGGTCGCTAC |
| Internal bar code: | CTCCTTTAGTCTACACGCCGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 145 |
| LEAP-Seq percent confirming: | 51.4286 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATAGGGTTGCCGTGTCCTTG |
| Suggested primer 2: | AGTCACATGAACGTGCCACT |